|
Eurofins
il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha Il 6 Nm 031168 Probe Eurofins 50cagataagctggagtcacagaaggagtgg 30 Tnf Alpha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/031168+30+50cagataagctggagtcacagaaggagtgg+6+alpha+eurofins+il+nm+probe+tnf/pm30995475-232-95-98 Average 86 stars, based on 1 article reviews
il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Servicebio Inc
fish Fish, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/fish+probes/pm38341853-183-28-32 Average 86 stars, based on 1 article reviews
fish - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Molecular Instruments
slc17a7 probeset ![]() Slc17a7 Probeset, supplied by Molecular Instruments, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/buffer+probe+wash/bio_rxiv__2025__10__11__681828-353-53-47 Average 86 stars, based on 1 article reviews
slc17a7 probeset - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Vaisala Inc
co2 probe ![]() Co2 Probe, supplied by Vaisala Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/CO2+Probe+GMP251/10__1093_slash_icesjms_slash_fsw011-2031-16-20 Average 95 stars, based on 1 article reviews
co2 probe - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
Vaisala Inc
hygrometer ![]() Hygrometer, supplied by Vaisala Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/Indigo200+Series+Transmitters+for+Vaisala+smart+probes/pm33676653-54-16-23 Average 95 stars, based on 1 article reviews
hygrometer - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
Toyobo
thunderbird sybr qpcr mix ![]() Thunderbird Sybr Qpcr Mix, supplied by Toyobo, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/THUNDERBIRD+Probe+qPCR+Mix/10__1016_slash_j__aqrep__2026__103594-113-5-9 Average 99 stars, based on 1 article reviews
thunderbird sybr qpcr mix - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Vazyme Biotech Co
hiscript ii one step qrt pcr probe kit ![]() Hiscript Ii One Step Qrt Pcr Probe Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/HiScript+II+U%2B+One+Step+qRT-PCR+Probe+Kit/pm42012180-163-21-28 Average 96 stars, based on 1 article reviews
hiscript ii one step qrt pcr probe kit - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Vazyme Biotech Co
multiple probe qpcr mix kit vazyme cat ![]() Multiple Probe Qpcr Mix Kit Vazyme Cat, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/Taq+Pro+U%2B+Multiple+Probe+qPCR+Mix/pm41916295-233-96-102 Average 94 stars, based on 1 article reviews
multiple probe qpcr mix kit vazyme cat - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
JEOL
mineral compositions ![]() Mineral Compositions, supplied by JEOL, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/JXA-8530FPlus+Electron+Probe+Microanalyzer/pm40379649-262-0-6 Average 96 stars, based on 1 article reviews
mineral compositions - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
JEOL
hyperprobe field emission electron probe microanalyser ![]() Hyperprobe Field Emission Electron Probe Microanalyser, supplied by JEOL, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/JXA-8530F+Electron+Probe+Microanalyzer/10__1007_slash_s00126___025___01367___7-86-11-10 Average 97 stars, based on 1 article reviews
hyperprobe field emission electron probe microanalyser - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
|
JEOL
jxa isp100 electron probe microanalysis ![]() Jxa Isp100 Electron Probe Microanalysis, supplied by JEOL, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/JXA-iSP100+Electron+Probe+Microanalyzer/10__1016_slash_j__oregeorev__2024__105923-136-17-16 Average 96 stars, based on 1 article reviews
jxa isp100 electron probe microanalysis - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
JEOL
carbon coated stubs ![]() Carbon Coated Stubs, supplied by JEOL, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dot-probe+or+visual+probe+tasks+(vpts)/JXA-8230+Electron+Probe+Microanalyzer/10__1016_slash_j__quascirev__2015__11__007-57-12-16 Average 97 stars, based on 1 article reviews
carbon coated stubs - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: Comprehensive profiling of transcription factors for reprogramming human astrocytes to neuronal cells through endogenous CRISPR-based gene activation
doi: 10.1101/2025.10.11.681828
Figure Lengend Snippet: A. ORF overexpression of annotated INSM1, LHX6, and ZNF276 isoforms. RNA levels of neuron marker genes shown. *p < 0.05, ***p < 0.001 by global one-way ANOVA with Dunnett’s post hoc test comparing all groups to mCherry. B. Immunofluorescence staining of reprogrammed cells to assess MAP2, NeuN, and SLC17A7 expression 25 days after transduction. C. Number of spikes (neuronal firing events) in 5-minute multi-electrode array recording 32 days post-transduction. D. Flow analysis of TUBB3-2A-mCherry expression expression as proxy for early neuronal differentiation 5 days post-transduction of VP64 dSpCas9 VP iPSCs with gRNA. E. Summary of mouse gRNA sublibrary. F. Significance (P adj ) versus fold change in gRNA abundance between MAP2-high and MAP2-low populations in mouse CRISPRa screen. G. Top enriched biological processes for upregulated DEGs (L2FC >1, p adj <0.01 determined by DESeq2 vs mCherry, n=121 genes) from RNA-seq 10 days after INSM1 ORF overexpression. Statistical significance of term enrichment was determined using a two-tailed Fisher’s exact test followed by Benjamini–Hochberg correction.
Article Snippet: SLC17A7 screen: To screen for factors that cooperate with INSM1 to enhance glutamatergic subtype specification, cells were sorted based on abundance of SLC17A7 RNA using HCR-FlowFISH according to the method described in Reilly et al. 2021 with the following modifications: SLC17A7 probeset and buffers were ordered from
Techniques: Over Expression, Marker, Immunofluorescence, Staining, Expressing, Transduction, RNA Sequencing, Two Tailed Test
Journal: bioRxiv
Article Title: Comprehensive profiling of transcription factors for reprogramming human astrocytes to neuronal cells through endogenous CRISPR-based gene activation
doi: 10.1101/2025.10.11.681828
Figure Lengend Snippet: A. Schematic of paired CRISPRa screens. B. Summary of TFpaired screening library. C. Scatter plot of z-score of gRNA abundance in the INSM1 MAP2 paired screen and the INSM1 SLC17A7 paired screen. D. Euler diagrams of differentially accessible peaks. Differential peaks (p adj <.01) for each sample were determined by DESeq2 vs. non-targeting gRNA. E. Top enriched biological processes for genes nearest top 1000 differentially accessible peaks by z-score for INSM1 (I), IKZF1 (IK), or peaks unique in only the combination of INSM1-IKZF1 (I+IK). Statistical significance of term enrichment was determined using a two-tailed Fisher’s exact test followed by Benjamini–Hochberg correction. F. Browser tracks of ATAC-seq (reads per kilobase per million mapped reads [RPKM]-normalized BigWig, bin size = 25bp. ‘Diff.peaks’ denotes peak significance between IKZF1-INSM1 and non-targeting using DESeq2. G. ANKS1B and KALRN peak accessibility and RNA expression indicate lack of significance after reprogramming with individual factors but significance after reprogramming with combination. H. Expression level ofANKS1B and KALRN in neural cell types in the Human Protein Atlas Single Cell Type data .
Article Snippet: SLC17A7 screen: To screen for factors that cooperate with INSM1 to enhance glutamatergic subtype specification, cells were sorted based on abundance of SLC17A7 RNA using HCR-FlowFISH according to the method described in Reilly et al. 2021 with the following modifications: SLC17A7 probeset and buffers were ordered from
Techniques: Two Tailed Test, RNA Expression, Expressing